DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_070215 |
| Line Availability | available from NASC (N570215) and ABRC (SALK_070215) |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At2g26190
| Sequence (A. th genome BLAST matches underlined) | GACTTGTTCGAACGCTTGTGACTGAAGTTCCATTGGATAAT |
| GenBank Accession | BH849732 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr2:11148051 - go to primer design |
| BLAST e Value | 7e-16 |
| Hit Clone Code (BAC ID) | T1D16 |
| Hit Gene Code | At2g26190 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | calmodulin-binding family protein |
| Insertion Classification | CDSi |
| Confirmation Status | failed |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 