DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_074103 |
| Line Availability | available from NASC (N574103) and ABRC (SALK_074103) |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At4g02730
| Sequence (A. th genome BLAST matches underlined) | GAACAATTAACGGAGTCGCTAACGCGAATT |
| GenBank Accession | BH852057 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:1207778 - go to primer design |
| BLAST e Value | 4e-07 |
| Hit Clone Code (BAC ID) | T10P11 |
| Hit Gene Code | At4g02730 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Transducin/WD40 repeat-like superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | failed |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 