DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_076258
Line Availability available from NASC (N576258) and ABRC (SALK_076258)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g34065

 
Sequence (A. th genome BLAST matches underlined) 
TATGAAATGAATCCAAGAATAACAATTCTCTTTCAGTATTTTGTGTATTTATCGTTTTGA
CATACCTGAACCATTAA
GenBank Accession BZ664575 [GenBank]
Graphic View Graphic view of gene At1g34065
Predicted Position of Insertion Chr1:12399064 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) F12G12
Hit Gene Code At1g34065 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosylmethionine carrier 2
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37