DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_079694
Line Availability available from NASC (N579694) and ABRC (SALK_079694)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g18320

 
Sequence (A. th genome BLAST matches underlined) 
ATGATACTATGACGGCTAGGTACCAGTTTGTGTTCACGGCAACCCTATTGGGGCAAAGGA
AGTTGGAATT
GenBank Accession BH856458 [GenBank]
Graphic View Graphic view of gene At1g18320
Predicted Position of Insertion Chr1:6304976 - go to primer design
BLAST e Value 4e-16
Hit Clone Code (BAC ID) F15H18
Hit Gene Code At1g18320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37