DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_082356
Line Availability available from NASC (N582356) and ABRC (SALK_082356)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g61710

 
Sequence (A. th genome BLAST matches underlined) 
TTCATCAGTATCCCTTTGGCTTTGCAACGATCAGTGTAAACCTGAGTTTGCATCTTCATT
TGCGCATAGAATCTGACGATGA
GenBank Accession BZ352811 [GenBank]
Graphic View Graphic view of gene At5g61710
Predicted Position of Insertion Chr5:24800505 - go to primer design
BLAST e Value 2e-37
Hit Clone Code (BAC ID) K11J9
Hit Gene Code At5g61710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cotton fiber protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37