DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_084650 |
| Line Availability | available from NASC (N584650) and ABRC (SALK_084650) |
| Parent of DUPLO pair | 12015 |
| Parent of pair(s) | none |
Gene hit At1g55630
| Sequence (A. th genome BLAST matches underlined) | GGGCTGAGCCGAGCTGGGAAGTTAGAAGCT |
| GenBank Accession | BZ594657 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:20792245 - go to primer design |
| BLAST e Value | 2e-09 |
| Hit Clone Code (BAC ID) | F20N2 |
| Hit Gene Code | At1g55630 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Pentatricopeptide repeat (PPR) superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | failed |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 