DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_098982c
Line Availability available from NASC (N664783) and ABRC (SALK_098982c)
Confirmed for Hit At5g09880
Parent of DUPLO pair 1842
Parent of pair(s) none

Gene hit At5g09880

 
Sequence (A. th genome BLAST matches underlined) 
ACAGAAAGAGAGGAGGAGGAGATAGGCATGGGGAAGATGGAGGTGACTAAGAGCGGGTTA
TCCGTCCGAGTTAGATTTCTCGCGGACACTGCGAAGAGATCGGTGGTGGTAAGACGGATC
GenBank Accession BZ664620 [GenBank]
Graphic View Graphic view of gene At5g09880
Predicted Position of Insertion Chr5:3085076 - go to primer design
BLAST e Value 3e-24
Hit Clone Code (BAC ID) MYH9
Hit Gene Code At5g09880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Splicing factor, CC1-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37