DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_104995c
Line Availability available from NASC (N663559) and ABRC (SALK_104995c)
Confirmed for Hit At5g61760
Parent of DUPLO pair 2340
Parent of pair(s) none

Gene hit At5g61760

 
Sequence (A. th genome BLAST matches underlined) 
AGATTTTCGATCACCAAAAATCTCGTTTTTGGAGAGCTGAAAACAAGCTGCAACCCGTCC
CTACATCCAATCTTAACATCCATTACCGACGGGTTTGCGTACCCTGAAACAACATCATCA
AGAACAAGATGAGGAAGCT
GenBank Accession BZ597439 [GenBank]
Graphic View Graphic view of gene At5g61760
Predicted Position of Insertion Chr5:24814501 - go to primer design
BLAST e Value 5e-36
Hit Clone Code (BAC ID) MAC9
Hit Gene Code At5g61760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation inositol polyphosphate kinase 2 beta
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37