DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_105665
Line Availability available from NASC (N605665) and ABRC (SALK_105665)
Parent of DUPLO pair 11895
Parent of pair(s) none

Gene hit At3g03290

 
Sequence (A. th genome BLAST matches underlined) 
TTTTTGTTAGAATTTGGACTCACCCCTGGTCGCTTTGTTTGGCAGAGTTTTTTAACAGTA
TGAACAACTCCATCGGGCTTTACTTCACTTTTCCGGTGCTTCCTTTTTCCTATAGCGAAT
ATACATCCTTAGAATT
GenBank Accession BH905145 [GenBank]
Graphic View Graphic view of gene At3g03290
Predicted Position of Insertion Chr3:767380 - go to primer design
BLAST e Value 4e-55
Hit Clone Code (BAC ID) T17B22
Hit Gene Code At3g03290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Adenine nucleotide alpha hydrolases-like superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37