DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_114687c
Line Availability available from NASC (N664836) and ABRC (SALK_114687c)
Parent of DUPLO pair 12165
Parent of pair(s) none

Gene hit At5g17600

 
Sequence (A. th genome BLAST matches underlined) 
CAAAATCACCGGTTTGGCTTTCATAACCGGCCAAATTCAAATTGATTTCAGATACCGAAC
CGGTTTGATGAGCAGAATT
GenBank Accession BZ380149 [GenBank]
Graphic View Graphic view of gene At5g17600
Predicted Position of Insertion Chr5:5800412 - go to primer design
BLAST e Value 4e-38
Hit Clone Code (BAC ID) K10A8
Hit Gene Code At5g17600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37