DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_118906
Line Availability available from NASC (N618906) and ABRC (SALK_118906)
Parent of DUPLO pair none
Parent of pair(s) 3771, 9823, 9847

Gene hit At5g49760

 
Sequence (A. th genome BLAST matches underlined) 
GCAGTGAATCGTTTCAGTACAGTGGGAATTTTCCAGCTTCAAAGCT
GenBank Accession CC057315 [GenBank]
Graphic View Graphic view of gene At5g49760
Predicted Position of Insertion Chr5:20220994 - go to primer design
BLAST e Value 9e-19
Hit Clone Code (BAC ID) K2I5
Hit Gene Code At5g49760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37