SimpleSearch - Line and FST details


Line specific information

 
Line ID 125E09
Vector Used pAC161
Line Availability available as T3 set from NASC (N411961)
Segregation Analysis 50:41:27
Confirmed for Hit At4g15770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g04215

 
Sequence (A. th genome BLAST matches underlined) 
>69-K104603-0022-125-E09-8409
TACAATTCATTCTTCATGTTCTCAAATAGAGAGCAATAAGTACGACGGACAGTACCGTCA
CTACTTGGCGTCATGGTAGATAGGTAGTGGATCTGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession FR803661 [GenBank]
Graphic View Graphic view of gene At4g04215
Predicted Position of Insertion Chr4:1141278 - go to primer design
BLAST e Value 3e-39
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g04215 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation long noncoding RNA
Insertion Classification TS2TE
Confirmation Status unknown
Other FSTs Supporting this Hit FR803660 [GenBank]

 
Line 125E09 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37