SimpleSearch - Line and FST details


Line specific information

 
Line ID 250D07
Vector Used pAC161
Line Availability only available from NASC (N423947)
Segregation Analysis 56:21:12
Confirmed for Hit At3g18040
Parent of DUPLO pair none
Parent of pair(s) 1152, 2397, 84313, 84314, 84315

Gene hit At3g18040

 
Sequence (A. th genome BLAST matches underlined)
>24-K118836-0022-250-D07C-8409
TCATTGAATATATCCTTTTCGCCGTATCCATCGGGTAATCGTAATCCTTACAAAAGTTGA
ATGTGATGCAGATATTAGAGTATCATCCTCAGATGCTGCAAGAATATCTTCGAGGTGGAG
AACAGACTAGCTTCATGTACCCAAGGTATATAAAAACATTTAGAATCCGTGTTCAAAATT
TACTACGAATTATGAGAAGTGAAGATAAAGATTTTGTAATCTAAATGAAAATGCAGTGGT
GTTGATCGCTTTAAGAGACAATTTGCTCATCTTGAGGAAAATTACGGTAAGGGTGAGAAA
GGCTCACCTCTTCAACGCCAACACGCTTCCTTGCCTAGGTATACAATTTCGTTTGTTGGT
TTGTCAGTAAAACTGATTTCCACGGATTC
GenBank Accession HG968844 [GenBank]
Graphic View Graphic view of gene At3g18040
Predicted Position of Insertion Chr3:6177334 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MRC8
Hit Gene Code At3g18040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAP kinase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942907 [GenBank] BX942907 [GenBank]


Last Updated on 31.08.2016 09:40