DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_000779
Line Availability available from NASC (N500779) and ABRC (SALK_000779)
Parent of DUPLO pair 11920
Parent of pair(s) none

Gene hit At4g36090

 
Sequence (A. th genome BLAST matches underlined)
GAGATCTCTGCAACGACTGTGCTCATGTTCTCTCCGATCGAATCCGTTCTCTAGACCCAG
GTTTGAATT
GenBank Accession ED571023 [GenBank]
Graphic View Graphic view of gene At4g36090
Predicted Position of Insertion Chr4:17080567 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) T19K4
Hit Gene Code At4g36090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation oxidoreductase, 2OG-Fe(II) oxygenase family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37