DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_010162
Line Availability available from NASC (N510162) and ABRC (SALK_010162)
Confirmed for Hit At4g36610
Parent of DUPLO pair 7905
Parent of pair(s) none

Gene hit At4g36610

 
Sequence (A. th genome BLAST matches underlined)
GAACTGCCACGTCACGATTCCTTCGCCAGCGAAACCATGGATTAACAAGACGACAGGCTT
TTTAGGTTTATCGGGTTTCGTTGGTTTTCCGGTACCGGAATT
GenBank Accession ED610833 [GenBank]
Graphic View Graphic view of gene At4g36610
Predicted Position of Insertion Chr4:17267038 - go to primer design
BLAST e Value 1e-51
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g36610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37