DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_027202
Line Availability available from NASC (N527202) and ABRC (SALK_027202)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g55910

 
Sequence (A. th genome BLAST matches underlined) 
AACTCAAGATAATTACTCTGATCAGATCTTACACTCAAAGATGCTGTTGCTGGCACAGCA
GGAGTAGGATTCAAAGCT
GenBank Accession BZ663600 [GenBank]
Graphic View Graphic view of gene At5g55910
Predicted Position of Insertion Chr5:22640068 - go to primer design
BLAST e Value 5e-28
Hit Clone Code (BAC ID) MWJ3
Hit Gene Code At5g55910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation D6 protein kinase
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37