DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_029432c
Line Availability available from NASC (N685547) and ABRC (SALK_029432c)
Parent of DUPLO pair 1079
Parent of pair(s) none

Gene hit At3g11405

 
Sequence (A. th genome BLAST matches underlined)
ACATTCCCCGTTTCACAAAAATATTGTTTGACTTTTACTTTTTCGTTCTAAGATATCAAT
CAAAATAATAATCTTTATTA
GenBank Accession ED578015 [GenBank]
Graphic View Graphic view of gene At3g11405
Predicted Position of Insertion Chr3:3580605 - go to primer design
BLAST e Value 1e-38
Hit Clone Code (BAC ID) F24K9
Hit Gene Code At3g11405 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification 5' region
Confirmation Status unknown
Other FSTs Supporting this Hit ED578014 [GenBank] BH753650 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37