DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_077867c
Line Availability available from NASC (N664705) and ABRC (SALK_077867c)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g10360

 
Sequence (A. th genome BLAST matches underlined)
GGAGAAGAAGAGAGTCTAAACCTCNTTCTTGGCCAAACTTTCACTACGGCGATCACGCTG
CTCCTTTAGTCTGGAGGAAAGAAGCT
GenBank Accession BH853596 [GenBank]
Graphic View Graphic view of gene At5g10360
Predicted Position of Insertion Chr5:3258756 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) F12B17
Hit Gene Code At5g10360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S6e
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37