DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_098628 |
Line Availability | available from NASC (N598628) and ABRC (SALK_098628) |
Parent of DUPLO pair | none |
Parent of pair(s) | 310 |
Gene hit At1g31814
Sequence (A. th genome BLAST matches underlined) | AGCTCTTCATTGATAGATAAACGCTTCCTCGAATT |
GenBank Accession | ED601872 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:11414048 - go to primer design |
BLAST e Value | 2e-12 |
Hit Clone Code (BAC ID) | F5M6 |
Hit Gene Code | At1g31814 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | FRIGIDA like 2 |
Insertion Classification | CDSi |
Confirmation Status | failed |
Last Updated on Thursday, 10 June 2021 13:37 |