DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_116082
Line Availability available from NASC (N616082) and ABRC (SALK_116082)
Parent of DUPLO pair none
Parent of pair(s) 11714

Gene hit At2g42130

 
Sequence (A. th genome BLAST matches underlined)
TTTTTCAACCTCAACGTCTCCGTCGAGATTTTGTCTCGCTGTTCCGGTGGTGAAGCACGG
TTGGAAGAATT
GenBank Accession BZ380993 [GenBank]
Graphic View Graphic view of gene At2g42130
Predicted Position of Insertion Chr2:17566292 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) T24P15
Hit Gene Code At2g42130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plastid-lipid associated protein PAP / fibrillin family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37