DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_151350c
Line Availability available from NASC (N658472) and ABRC (SALK_151350c)
Parent of DUPLO pair 12287
Parent of pair(s) none

Gene hit At5g15610

 
Sequence (A. th genome BLAST matches underlined) 
GAACCCACATAAAAGGGTGGCAGACTTTGGTTTTCTCTTTTAAATCCAAGAGATGTAGAA
TAGAAACTTGGCGGACAATTACAACTTGGTTCATCAGATCCATCTTACAAGCAAACAATT
TTGCCGTTATTGCCTTAACCACCCACAATTCAACCCCCTCGTCATTTACCTGGACCCCCC
ACCAAATCCATGAG
GenBank Accession ED605718 [GenBank]
Graphic View Graphic view of gene At5g15610
Predicted Position of Insertion Chr5:5081604 - go to primer design
BLAST e Value 5e-46
Hit Clone Code (BAC ID) T20K14
Hit Gene Code At5g15610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Proteasome component (PCI) domain protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37