SimpleSearch - Line and FST details
Line specific information
| Line ID | 004D08 |
| Vector Used | pAC106 |
| Line Availability | available as T3 set from NASC (N400332) |
| Segregation Analysis | 50:22:18 |
| Confirmed for Hit | At3g24463 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 2745 |
Gene hit At3g24463
| Sequence (A. th genome BLAST matches underlined) | >60-K014807-022-004-D08-8409 ACGAAGTGGAAGATAATGAATGGTATTTGGGCTACCTTCTCCCACATATGATGATGG |
| GenBank Accession | AL751472 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr3:8887800 - go to primer design |
| BLAST e Value | 4e-04 |
| Hit Clone Code (BAC ID) | MXP5 |
| Hit Gene Code | At3g24463 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | nuclear transport factor 2 family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
