SimpleSearch - Line and FST details
Line specific information
Line ID | 004D08 |
Vector Used | pAC106 |
Line Availability | available as T3 set from NASC (N400332) |
Segregation Analysis | 50:22:18 |
Confirmed for Hit | At3g24463 |
Parent of DUPLO pair | none |
Parent of pair(s) | 2745 |
Gene hit At3g24463
Sequence (A. th genome BLAST matches underlined) | >60-K014807-022-004-D08-8409 ACGAAGTGGAAGATAATGAATGGTATTTGGGCTACCTTCTCCCACATATGATGATGG |
GenBank Accession | AL751472 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr3:8887800 - go to primer design |
BLAST e Value | 4e-04 |
Hit Clone Code (BAC ID) | MXP5 |
Hit Gene Code | At3g24463 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | nuclear transport factor 2 family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on 10.06.2021 13:37 |