SimpleSearch - Line and FST details


Line specific information

 
Line ID 021D08
Vector Used pAC106
Line Availability available as T3 set from NASC (N401964)
Segregation Analysis 50:47:38
Confirmed for Hit At1g64180
Parent of DUPLO pair 2025
Parent of pair(s) none

Gene hit At1g64180

 
Sequence (A. th genome BLAST matches underlined) 
>60-K013749-022-021-D08-8409
TTGAGCTACTGATACCAGTCTCTCTCTATCCTTCTCTTCCTATGGGATCCTCCCTATAGT
GAGAGNCANNNNANGNNNNNNACCANTGGNNTTCCTTTAATTTGGGACCGCCCGGCCCGT
ATATTAAAAGGAGAGATCTTGTTAATATAACGACAAATAA
GenBank Accession FR800652 [GenBank]
Graphic View Graphic view of gene At1g64180
Predicted Position of Insertion Chr1:23822019 - go to primer design
BLAST e Value 0.024
Hit Clone Code (BAC ID) F22C12
Hit Gene Code At1g64180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation intracellular protein transport protein USO1-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR800652 [GenBank]


Last Updated on 10.06.2021 13:37