SimpleSearch - Line and FST details


Line specific information

 
Line ID 064A08
Vector Used pAC161
Line Availability available as T3 set from NASC (N406056)
Segregation Analysis 50:49:42
Confirmed for Hit At5g44160
Parent of DUPLO pair 2477
Parent of pair(s) none

Gene hit At5g44160

 
Sequence (A. th genome BLAST matches underlined) 
>57-K025916-022-064-A08-8409
CCAGAGATCAGTTAATCTCAACTATCAATATCTCATGGGAACATTCATCCCACCGCTTCA
ACCATTTGTATGGGATCCTCCCTATAGTGAGAGGGACTTTTAAACATCATCCGTCGGATG
GCGTTGCGAGAGAAGCAGTCGATCCGTGAGATCAGCCGACGCACCGGGCAGGCGCGCAAC
ACGATCGCAAAGTATTTGAACGCAGGTATGGGATCCTCCCTATAGTGAGAC
GenBank Accession CR396079 [GenBank]
Graphic View Graphic view of gene At5g44160
Predicted Position of Insertion Chr5:17774695 - go to primer design
BLAST e Value 8e-29
Hit Clone Code (BAC ID) MLN1
Hit Gene Code At5g44160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation C2H2-like zinc finger protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396080 [GenBank] CR396079 [GenBank]


Last Updated on 10.06.2021 13:37