SimpleSearch - Line and FST details


Line specific information

 
Line ID 072B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N406839)
Segregation Analysis 100:87:70
Confirmed for Hit At1g14360
Parent of DUPLO pair 151
Parent of pair(s) none

Gene hit At1g14360

 
Sequence (A. th genome BLAST matches underlined) 
>82-011723-strizhov-B11-oriL
GATCCATGGTAGAATTTCCCGGCACATGAAGCATCAAAGGCAAGTTTTAAGAAGACAAAG
CCGTAACAAGGGGTGCATTGGGATGTGCTATGGGATACTCTCTATAGTGAGTCGTATTAC
TC
GenBank Accession BX546523 [GenBank]
Graphic View Graphic view of gene At1g14360
Predicted Position of Insertion Chr1:4911902 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-galactose transporter 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37