SimpleSearch - Line and FST details


Line specific information

 
Line ID 158E10
Vector Used pAC161
Line Availability available as T3 set from NASC (N415130)
Segregation Analysis 50:40:34
Confirmed for Hit At3g55980
Parent of DUPLO pair 7910
Parent of pair(s) none

Gene hit At3g55980

 
Sequence (A. th genome BLAST matches underlined)
>77-K013215-022-158-E10-8409
NTGATCCATGTAGATTTCCCCGGACTGAANGCCTTTACCATGAGTCTCAATTCCATCTCC
ATCTCCTATCGATATCTCTATGAAATCCTCCTATAGTGA
GenBank Accession FR804712 [GenBank]
Graphic View Graphic view of gene At3g55980
Predicted Position of Insertion Chr3:20778077 - go to primer design
BLAST e Value 7e-09
Hit Clone Code (BAC ID) F27K19
Hit Gene Code At3g55980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation salt-inducible zinc finger 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37