SimpleSearch - Line and FST details


Line specific information

 
Line ID 215B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N420566)
Segregation Analysis 100:95:72
Confirmed for Hit At1g50410
Parent of DUPLO pair 11688
Parent of pair(s) none

Gene hit At1g50410

 
Sequence (A. th genome BLAST matches underlined) 
>74-K014140-022-215-B10-8409
NTTTTGATCCATGTAGCATTTCCCGGACATGAAGCGCTTTACAATTGAAGTGCCTTGGTT
AGAAAGCGACTGCAGAATATCTAAGACAGCTTTGATCTTTGATGAACTAAACTCGCCATT
CTGAAAAACTGATTTATCATGACTATTATCCTCTGAGGAACTACAACCCAAATCATGCAG
CAACGCAACTTCTAAGCGTGGATTTAGAGAAAACAACATCATGCGCAAGCTGTTCTCTGC
ATCTATGGGATCCTCCCTTAGGTGAG
GenBank Accession BX890884 [GenBank]
Graphic View Graphic view of gene At1g50410
Predicted Position of Insertion Chr1:18676588 - go to primer design
BLAST e Value 5e-105
Hit Clone Code (BAC ID) F14I3
Hit Gene Code At1g50410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37