SimpleSearch - Line and FST details


Line specific information

 
Line ID 243B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N423255)
Segregation Analysis 100:77:57
Confirmed for Hit At5g45300
Parent of DUPLO pair 7972
Parent of pair(s) none

Gene hit At5g45300

 
Sequence (A. th genome BLAST matches underlined) 
>82-K014396-022-243-B11-8409
TATGTGCAGGCCTATGGGATCCTCCCTACTAAACAGAACANNCNCGGAATATTTCTTCAG
AGTTTCGAAAACAAGAGAGTACCCATCACGGATCGAAGGGCTGTAGTATCCTGCAGTTTA
TTCCGCAGCATGACTA
GenBank Accession BX649798 [GenBank]
Graphic View Graphic view of gene At5g45300
Predicted Position of Insertion Chr5:18356277 - go to primer design
BLAST e Value 9e-33
Hit Clone Code (BAC ID) K9E15
Hit Gene Code At5g45300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta-amylase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649798 [GenBank]


Last Updated on 10.06.2021 13:37