SimpleSearch - Line and FST details


Line specific information

 
Line ID 272B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N426039)
Segregation Analysis 50:42:34
Confirmed for Hit At3g07720
Parent of DUPLO pair none
Parent of pair(s) 2637, 68477

Gene hit At3g07720

 
Sequence (A. th genome BLAST matches underlined) 
>82-K015096-022-272-B11-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATCCGCAGTAATAGAGTGGT
AGCTTCGGTTCTGTGGACCGGTTTCCCCTGAAGAGAGTAGTTTCCACTGGTTGGTCAAAG
TGTTAAAACAGTATAACTCGTTGAGCTCCTGGTGAGTCGAGTCCCGGCCACCAAAGAAAT
AGATGATAGGGTCCGACTGCAGCCATGGCTACACCTACCCTATGGGATCC
GenBank Accession AL943167 [GenBank]
Graphic View Graphic view of gene At3g07720
Predicted Position of Insertion Chr3:2466446 - go to primer design
BLAST e Value 8e-92
Hit Clone Code (BAC ID) MLP3
Hit Gene Code At3g07720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL943167 [GenBank]


Last Updated on 10.06.2021 13:37