SimpleSearch - Line and FST details


Line specific information

 
Line ID 283F10
Vector Used pAC161
Line Availability available as T3 set from NASC (N427142)
Segregation Analysis 50:42:31
Confirmed for Hit At4g12120
Parent of DUPLO pair none
Parent of pair(s) 1520, 75879

Gene hit At4g12120

 
Sequence (A. th genome BLAST matches underlined) 
>78-K015178-022-283-F10-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTGTACAATTGAGATATTGCCTGACAC
ATGCACCCAGAAACGAAGCGTTCTTTTACCCTTTCTCTTACAATTTTCGGATTTTTCGAA
ATTGGGTTTTTGATTAGATCATATAGACTCTGTTATAGGGTCCGTCTAGGAAGCTGCTGG
TCTCTATGGGATCCTCCC
GenBank Accession AL944644 [GenBank]
Graphic View Graphic view of gene At4g12120
Predicted Position of Insertion Chr4:7260857 - go to primer design
BLAST e Value 4e-29
Hit Clone Code (BAC ID) F16J13
Hit Gene Code At4g12120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sec1/munc18-like (SM) proteins superfamily
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944644 [GenBank]


Last Updated on 10.06.2021 13:37