SimpleSearch - Line and FST details


Line specific information

 
Line ID 374D04
Vector Used pAC161
Line Availability available as T3 set from NASC (N435848)
Segregation Analysis 50:47:33
Confirmed for Hit At5g45710
Parent of DUPLO pair 2669
Parent of pair(s) none

Gene hit At5g45710

 
Sequence (A. th genome BLAST matches underlined) 
>28-K017166-022-374-D04-8409
ACTTTGCTTCTAAAGCTTGAGAGATGATTTTTTCTCAAAAAAAGAGGGGACCGCGCGTCT
TAAACTGGAATGAGAGGATTAAATGTTTATGAATTCAATGAGTCTTTTTATCCCCC
GenBank Accession BX003722 [GenBank]
Graphic View Graphic view of gene At5g45710
Predicted Position of Insertion Chr5:18541326 - go to primer design
BLAST e Value 0.094
Hit Clone Code (BAC ID) MRA19
Hit Gene Code At5g45710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation winged-helix DNA-binding transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX003722 [GenBank]


Last Updated on 10.06.2021 13:37