SimpleSearch - Line and FST details


Line specific information

 
Line ID 417H11
Vector Used pAC161
Line Availability available as T3 set from NASC (N440031)
Segregation Analysis 50:45:34
Confirmed for Hit At5g47310
Parent of DUPLO pair 2345
Parent of pair(s) none

Gene hit At5g47310

 
Sequence (A. th genome BLAST matches underlined) 
>88-K018046-022-417-H11-8409
GGACATGAGCCATTTACATTGATATATCAGAGCGAGACATGCTGGTGGTTCCCAACAAAA
CTGAGCGCCTAAAGATGAACCTGGACAGCTCCTATGGGATCCTCCCTATAGTGAGAGNNN
NCANTNTNTANTATCNCTCGTGTTTTCTACATTCTTGAAGTGAATGAACATGGCGATTAC
TCTAATCTGTTTCTCCTTATTGAACAACATACTCATTGCTGATCCATGTATATTTCGCGG
ACATGAAGACCTTTACATTTGAATATATAAGAG
GenBank Accession BX288591 [GenBank]
Graphic View Graphic view of gene At5g47310
Predicted Position of Insertion Chr5:19202054 - go to primer design
BLAST e Value 8e-27
Hit Clone Code (BAC ID) MQL5
Hit Gene Code At5g47310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PPPDE putative thiol peptidase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX288591 [GenBank]


Last Updated on 10.06.2021 13:37