SimpleSearch - Line and FST details


Line specific information

 
Line ID 584A07
Vector Used pAC161
Line Availability available as T3 set from NASC (N455975)
Segregation Analysis 50:48:35
Confirmed for Hit At4g00220
Parent of DUPLO pair 12485
Parent of pair(s) none

Gene hit At4g00220

 
Sequence (A. th genome BLAST matches underlined) 
>49-K021752-022-584-A07-8409
CACATTTAATATAAAGACATAACTTTGCCCACAAGGCAAAGGCCCTGAACCCAGTTGTAA
AATTTTAGATTTTTAAAACTCCTATTTTAATGTACAGTTGGTTTTCCATCCTGGCCAAAA
CCAAAAATATTCCTCCCTAAAAGAACAAATCCGAATGAATTAAAAAAAAAAACCCATCCA
AAAAAAAGG
GenBank Accession BX654835 [GenBank]
Graphic View Graphic view of gene At4g00220
Predicted Position of Insertion Chr4:90966 - go to primer design
BLAST e Value 3e-59
Hit Clone Code (BAC ID) F6N15
Hit Gene Code At4g00220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Lateral organ boundaries (LOB) domain family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37