SimpleSearch - Line and FST details


Line specific information

 
Line ID 600G07
Vector Used pAC161
Line Availability available as T3 set from NASC (N457583)
Segregation Analysis 50:46:46
Confirmed for Hit At1g73980
Parent of DUPLO pair 2525
Parent of pair(s) none

Gene hit At1g73980

 
Sequence (A. th genome BLAST matches underlined) 
>55-K023189-022-600-G07-8409
ACATGAAGCCATTTACAATTGAATATATCCTGGACCAACTCTCCACAATCAAAACCCTTT
ATGCTCACGTTCTATTATTGATTGGCTTCACTCCAATAGACAACAACAGAGCATCAGATG
CATCAAAGAGAGCTTTAGACTCGATAGAAGTATGAATATAAGATAGAGATCTATCGGATC
CTCCCTATAGTGAGCCCGCCCCCCCCCGGGGGGG
GenBank Accession BX892295 [GenBank]
Graphic View Graphic view of gene At1g73980
Predicted Position of Insertion Chr1:27820714 - go to primer design
BLAST e Value 5e-52
Hit Clone Code (BAC ID) F2P9
Hit Gene Code At1g73980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphoribulokinase / Uridine kinase family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37