SimpleSearch - Line and FST details


Line specific information

 
Line ID 622B07
Vector Used pAC161
Line Availability available as T3 set from NASC (N459635)
Segregation Analysis 50:34:20
Confirmed for Hit At2g39960
Parent of DUPLO pair 12562
Parent of pair(s) none

Gene hit At2g39960

 
Sequence (A. th genome BLAST matches underlined) 
>50-K021997-022-622-B07-8409
TACAATTGTATTGTATTTCTGTGATTTAGGTGCATAATGTACCTTTTTTCCTTGTTCACT
TACTTTTAACTGGAGCTATAGTTTGAATTCTGGTGTCAAACTTTTGCATTCCTTTTGTTT
TGTATTTTGTTTCTGCTTGCCTGACATGTTATGTAAAGTTTGCAACTTTGCATATCTTAA
GGCATCTTTTTTTTTTTTTA
GenBank Accession BX657048 [GenBank]
Graphic View Graphic view of gene At2g39960
Predicted Position of Insertion Chr2:16682743 - go to primer design
BLAST e Value 5e-101
Hit Clone Code (BAC ID) T28M21
Hit Gene Code At2g39960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Microsomal signal peptidase 25 kDa subunit (SPC25)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37