SimpleSearch - Line and FST details


Line specific information

 
Line ID 652D01
Vector Used pAC161
Line Availability available as T3 set from NASC (N462533)
Segregation Analysis 50:46:39
Confirmed for Hit At2g19120
Parent of DUPLO pair 12487
Parent of pair(s) none

Gene hit At2g19120

 
Sequence (A. th genome BLAST matches underlined) 
>04-K023205-022-652-D01-8409
ATTCAGGAGCGCTGGATATACTTTCACTGTCTTTGAGGCGTCCTTGGTAGAAGTACCTTG
AAGGAAAATCTCGAATTTGAGGATGCATTCTGTATTGAACAGTCAATAACAAAGTCGGAC
AGCCTGCTATGGGATCCTCCCTATAGCGAGCCCC
GenBank Accession BX893730 [GenBank]
Graphic View Graphic view of gene At2g19120
Predicted Position of Insertion Chr2:8287768 - go to primer design
BLAST e Value 8e-66
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814136 [GenBank] FR814136 [GenBank]


Last Updated on 10.06.2021 13:37