SimpleSearch - Line and FST details


Line specific information

 
Line ID 671E09
Vector Used pAC161
Line Availability available as T3 set from NASC (N464377)
Segregation Analysis 50:43:41
Confirmed for Hit At3g12100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g12100

 
Sequence (A. th genome BLAST matches underlined)
>69-K023048-022-671-E09-8409
AGTAAGTAAGCCATTTTTTACTTCGGCAAATACTAAAATCAACAGNTCAGTCGTATGGGG
ATCCTCCCTATAGTGAG
GenBank Accession BX661173 [GenBank]
Graphic View Graphic view of gene At3g12100
Predicted Position of Insertion Chr3:3857296 - go to primer design
BLAST e Value 1e-06
Hit Clone Code (BAC ID) T21B14
Hit Gene Code At3g12100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cation efflux family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37