SimpleSearch - Line and FST details


Line specific information

 
Line ID 676A06
Vector Used pAC161
Line Availability available as T3 set from NASC (N464806)
Segregation Analysis 50:50:48
Confirmed for Hit At5g59710
Parent of DUPLO pair 81
Parent of pair(s) none

Gene hit At5g59710

 
Sequence (A. th genome BLAST matches underlined) 
>41-K023001-022-676-A06-8409
CAGCCATTTACAATTGTAAATCAACATAATCTTACTCTGTCTTCACGACTAAATTTGGCA
GCAAATAGCGGATCAGGATTAAATGTTCAGGGACAGAACCCAATGATGGGTGGAGTATGG
GATCCTCCCTATAGTGAG
GenBank Accession BX661487 [GenBank]
Graphic View Graphic view of gene At5g59710
Predicted Position of Insertion Chr5:24059012 - go to primer design
BLAST e Value 1e-36
Hit Clone Code (BAC ID) MTH12
Hit Gene Code At5g59710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation VIRE2 interacting protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37