SimpleSearch - Line and FST details


Line specific information

 
Line ID 700B03
Vector Used pGABI1
Line Availability available as T3 set from NASC (N467119)
Segregation Analysis 50:41:28
Confirmed for Hit At1g32530
Parent of DUPLO pair 2367
Parent of pair(s) none

Gene hit At1g32530

 
Sequence (A. th genome BLAST matches underlined)
>18-K025069-022-700-B03-8409
AATCTTCTGGACCAACAGTAACGGTGGGTCGGATCTAAATGCAGCGGCTTTGATCCTACG
GGTCGGTTTCACGTGCTTCTCCCTCACAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX944617 [GenBank]
Graphic View Graphic view of gene At1g32530
Predicted Position of Insertion Chr1:11762306 - go to primer design
BLAST e Value 1e-33
Hit Clone Code (BAC ID) F5D14
Hit Gene Code At1g32530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX944617 [GenBank]


Last Updated on 10.06.2021 13:37