SimpleSearch - Line and FST details


Line specific information

 
Line ID 706H05
Vector Used pGABI1
Line Availability available as T3 set from NASC (N467769)
Segregation Analysis 50:50:38
Confirmed for Hit At2g25850
Parent of DUPLO pair none
Parent of pair(s) 2867

Gene hit At2g25850

 
Sequence (A. th genome BLAST matches underlined) 
>40-K025108-022-706-H05-8409
AGAGCCCCTCACCACCCCGAAACTTCACAATAAATCCGCCCAAACGCAAGTCCATATCCC
ATTGTTCCCGAAAGCCATTTTTCCTTGGAACAAAAAAACCAACCAACCCCACGCCAACCC
TCCCCAGTTCCAAATTACGCCTAACATCCGCCGCAGAAGGTCCAGCAATAGACCGTGGCT
CCGTGATCCCCTAGCTCCTAAGAGAAGCTTTTACCGGTTGAGAAGAGTCATCGTCCGTGC
GTTGTTGAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX945274 [GenBank]
Graphic View Graphic view of gene At2g25850
Predicted Position of Insertion Chr2:11030182 - go to primer design
BLAST e Value 5e-70
Hit Clone Code (BAC ID) F17H15
Hit Gene Code At2g25850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation poly(A) polymerase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX945274 [GenBank]


Last Updated on 10.06.2021 13:37