SimpleSearch - Line and FST details
Line specific information
| Line ID | 707G06 |
| Vector Used | pGABI1 |
| Line Availability | available as T3 set from NASC (N467854) |
| Segregation Analysis | 50:47:31 |
| Confirmed for Hit | At4g28320 |
| Parent of DUPLO pair | 2716 |
| Parent of pair(s) | none |
Gene hit At4g28320
| Sequence (A. th genome BLAST matches underlined) | >47-K023059-022-707-G06-8409 CGCAGGTTCTGCTCACCAGGAAGAACTCTGTAACGGGAATAGAGTATGGGATCCTCCCTA TAGTGAG |
| GenBank Accession | BX662676 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:14019226 - go to primer design |
| BLAST e Value | 2e-17 |
| Hit Clone Code (BAC ID) | F26K10 |
| Hit Gene Code | At4g28320 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Glycosyl hydrolase superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |