SimpleSearch - Line and FST details


Line specific information

 
Line ID 715E05
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468597)
Segregation Analysis 50:48:44
Confirmed for Hit At5g63780
Parent of DUPLO pair 11824
Parent of pair(s) none

Gene hit At5g63780

 
Sequence (A. th genome BLAST matches underlined)
>37-K025039-022-715-E05-8409
TACATTGAAACATGCAAATGGAACCTCCTGATAATGTCATCTTAGCAACTAAATCTGATC
TGAATAAATCTGTTGTCCAAAGCCATGGACGGAAATCTGGCTTCTTATAAGTACCACGTC
CGGATGCGGACCTTTTCAATTGCACATTCGATATATCAAGTGGCAATCCACCCACTACTA
GATGCATTGATTGATCT
GenBank Accession FR814939 [GenBank]
Graphic View Graphic view of gene At5g63780
Predicted Position of Insertion Chr5:25525402 - go to primer design
BLAST e Value 6e-05
Hit Clone Code (BAC ID) MBK5
Hit Gene Code At5g63780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/FYVE/PHD zinc finger superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37