SimpleSearch - Line and FST details


Line specific information

 
Line ID 787G02
Vector Used pAC161
Line Availability available as T3 set from NASC (N475530)
Segregation Analysis 50:47:39
Confirmed for Hit At5g57480
Parent of DUPLO pair none
Parent of pair(s) 2678, 97122

Gene hit At5g57480

 
Sequence (A. th genome BLAST matches underlined) 
>15-K024947-022-787-G02-8409
AGAGGGCAATAGATAGTCGAAATGAAGATGAGGATCATGATGAAGAAGAGATTGAGCTTG
AGGATAACATTTGTAAGACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCGGGGGGG
TTTGGGGATTTGGGAGCTCATGGGGTCTGTCCCCCTAGGGAGCCGGGGGGATGC
GenBank Accession BX948150 [GenBank]
Graphic View Graphic view of gene At5g57480
Predicted Position of Insertion Chr5:23279497 - go to primer design
BLAST e Value 6e-36
Hit Clone Code (BAC ID) MUA2
Hit Gene Code At5g57480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37