SimpleSearch - Line and FST details


Line specific information

 
Line ID 840C06
Vector Used pAC106
Line Availability available as T3 set from NASC (N480574)
Segregation Analysis 50:20:14
Confirmed for Hit At1g71710
Parent of DUPLO pair 2584
Parent of pair(s) none

Gene hit At1g71710

 
Sequence (A. th genome BLAST matches underlined) 
>43-K025827-022-840-C06-8409
TTTACAGTAAAGTTAGACAAATCGAAACCGTAACGGGTTTTTTGAGTTAAAGATTTATTT
GGAAGAGAGAAAAAAAGACTGACTCGTGATCATAGATAAGCTTGGGAAGTCCAAGAGCTG
AGACAGAGTGAAAGACTGTTCTTTTATGTATCTCGGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR400818 [GenBank]
Graphic View Graphic view of gene At1g71710
Predicted Position of Insertion Chr1:26974449 - go to primer design
BLAST e Value 5e-67
Hit Clone Code (BAC ID) F14O23
Hit Gene Code At1g71710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNAse I-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR400819 [GenBank]


Last Updated on 10.06.2021 13:37