SimpleSearch - Line and FST details


Line specific information

 
Line ID 848H04
Vector Used pAC106
Line Availability available as T3 set from NASC (N481400)
Segregation Analysis 50:39:37
Confirmed for Hit At1g18320
Parent of DUPLO pair 11943
Parent of pair(s) none

Gene hit At1g18320

 
Sequence (A. th genome BLAST matches underlined) 
>32-K025835-022-848-H04-8409
AAAAACTGCGACCCTACTGCTGAAACTGTCTGTCAGTCGCGTATCAGATCGGATATTCCA
CGCTTTCCCCATCTATATTGCTCCATTGCTCTTGCTTTTCCAAAAATGCTAAAAGCTCTA
AGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR401734 [GenBank]
Graphic View Graphic view of gene At1g18320
Predicted Position of Insertion Chr1:6304445 - go to primer design
BLAST e Value 6e-20
Hit Clone Code (BAC ID) F15H18
Hit Gene Code At1g18320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR401734 [GenBank]


Last Updated on 10.06.2021 13:37