SimpleSearch - Line and FST details


Line specific information

 
Line ID 884A06
Vector Used pAC161
Line Availability available as T3 set from NASC (N484774)
Segregation Analysis 50:50:35
Confirmed for Hit At3g11930
Parent of DUPLO pair none
Parent of pair(s) 2766

Gene hit At3g11930

 
Sequence (A. th genome BLAST matches underlined)
>41-K028883-022-884-A06-8409
TACTTTGACCTGTTTGAGTCGTGCCAAGGCCACAGACTACCCACAACGAAGAAGATCAAC
GTGCATTTTCTCCACCGCCTCAGAAATCATCTCCTTCGCCTCGCCTTCTAGCACTAGAGT
TTCAGTATGGGATCCTCCCTATAGTGAGACGTATTACTT
GenBank Accession CR935074 [GenBank]
Graphic View Graphic view of gene At3g11930
Predicted Position of Insertion Chr3:3777268 - go to primer design
BLAST e Value 9e-42
Hit Clone Code (BAC ID) F26K24
Hit Gene Code At3g11930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Adenine nucleotide alpha hydrolases-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37