SimpleSearch - Line and FST details


Line specific information

 
Line ID 899C10
Vector Used pAC161
Line Availability available as T3 set from NASC (N486242)
Segregation Analysis 50:49:40
Confirmed for Hit At4g26420
Parent of DUPLO pair 12041
Parent of pair(s) none

Gene hit At4g26420

 
Sequence (A. th genome BLAST matches underlined) 
>75-K030281-022-899-C10-8409
TCCTGCTACCACAATATCCTCTTTGCGACGTTTCCAGAACTCGACTAAGTCCTTGTCTGC
TTGCTCCGCGTATGCCTCCGCGACTTCTTTTTCTGCTCCTTCAATCCACACCCCTCCCTT
GTTCCATGACTTCGATCCTTTCTCCATCACTTTTTCAGGTATGGGATCCTCCCTATAGTG
AGTCGTATTACTCAT
GenBank Accession CR935795 [GenBank]
Graphic View Graphic view of gene At4g26420
Predicted Position of Insertion Chr4:13351374 - go to primer design
BLAST e Value 4e-74
Hit Clone Code (BAC ID) M3E9
Hit Gene Code At4g26420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR935795 [GenBank]


Last Updated on 10.06.2021 13:37