DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_006755
Line Availability available from NASC (N506755) and ABRC (SALK_006755)
Parent of DUPLO pair 11927
Parent of pair(s) none

Gene hit At1g13390

 
Sequence (A. th genome BLAST matches underlined) 
TCAATCAAACAATCATCAACAAGCAAAAGGGTTGTTATTGAATCATATATATACCTTTGT
GAGGATGAAATCCAAAATCTCACTTCCTGAATT
GenBank Accession ED607871 [GenBank]
Graphic View Graphic view of gene At1g13390
Predicted Position of Insertion Chr1:4593191 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase subunit seca
Insertion Classification CDSi
Confirmation Status failed
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37