DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_007212
Line Availability available from NASC (N507212) and ABRC (SALK_007212)
Confirmed for Hit At4g32610
Parent of DUPLO pair 12252
Parent of pair(s) none

Gene hit At4g32610

 
Sequence (A. th genome BLAST matches underlined) 
TTCACATGTTGAAAATTGTAACACTGGTTTAATATGTCTCTTGCAATAAGCCTCTTTAGA
TTTCAAATGCTTCCACGAATTGAATGAGTTGGCCTTTTTTTCTACTGTTGTTATCTCGCT
TAGGCTTAGGCTTGTGTTGTCTGAATT
GenBank Accession ED608308 [GenBank]
Graphic View Graphic view of gene At4g32610
Predicted Position of Insertion Chr4:15729513 - go to primer design
BLAST e Value 7e-66
Hit Clone Code (BAC ID) F4D11
Hit Gene Code At4g32610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation copper ion binding protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37