DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_008764 |
Line Availability | available from NASC (N508764) and ABRC (SALK_008764) |
Parent of DUPLO pair | none |
Parent of pair(s) | 12183 |
Gene hit At1g70780
Sequence (A. th genome BLAST matches underlined) | ACCATTAATGGTGCAAGAAAAGGTGGAAGCT |
GenBank Accession | ED609700 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:26695542 - go to primer design |
BLAST e Value | 4e-10 |
Hit Clone Code (BAC ID) | F5A18 |
Hit Gene Code | At1g70780 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | hypothetical protein |
Insertion Classification | CDSi |
Confirmation Status | unknown |
Last Updated on Thursday, 10 June 2021 13:37 |