DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_008764 |
| Line Availability | available from NASC (N508764) and ABRC (SALK_008764) |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 12183 |
Gene hit At1g70780
| Sequence (A. th genome BLAST matches underlined) | ACCATTAATGGTGCAAGAAAAGGTGGAAGCT |
| GenBank Accession | ED609700 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr1:26695542 - go to primer design |
| BLAST e Value | 4e-10 |
| Hit Clone Code (BAC ID) | F5A18 |
| Hit Gene Code | At1g70780 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | hypothetical protein |
| Insertion Classification | CDSi |
| Confirmation Status | unknown |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 